This is a working overview of NAMPT, written for readers who want more than a one-paragraph summary but less than a textbook.
Reviewed 2026-08-01. Anything still debated is marked as such rather than presented as settled.
Stability of NMN depends on physical form, temperature, moisture, light, and pH. The solid compound is generally more stable than aqueous solutions, which can degrade over time, especially when warm or exposed to extreme pH. Recommended laboratory storage is typically desiccated at −20 °C or below, protected from light, with containers sealed to limit moisture uptake. In solution, degradation products may include nicotinamide and related ribosides, and the rate varies with buffer composition and concentration. Analytical laboratories often prepare fresh solutions and validate stability for each method.
Quality control for NMN materials usually covers identity, assay purity, residual solvents, heavy metals, microbial limits, and moisture content. Certificates of analysis from suppliers may report high-performance liquid chromatography purity, mass spectrometry identity, and elemental impurity testing. Regulatory treatment differs by country: NMN is not an approved drug, and its status as a dietary supplement ingredient or novel food has been debated. Some authorities have restricted sales pending safety and regulatory review, while others allow it under specific categories. Buyers should verify documentation rather than rely on label claims.
Nicotinamide mononucleotide, abbreviated NMN, is a naturally occurring nucleotide. Its structure combines a nicotinamide base with a ribose sugar and a phosphate group. Within cells, NMN sits on the biosynthetic route that recycles nicotinamide back into nicotinamide adenine dinucleotide, or NAD+. Because NAD+ participates in redox reactions and signaling, enzymes that produce and consume it influence many metabolic processes. The compound is therefore best described as an intermediate rather than a final signaling molecule.
In the canonical salvage pathway, nicotinamide phosphoribosyltransferase, known as NAMPT, transfers a phosphoribosyl group to nicotinamide and releases NMN. A second enzyme, NMN adenylyltransferase, then attaches an adenylyl group to NMN to form NAD+. Alternative routes exist, including a pathway that uses nicotinamide riboside and its phosphorylated forms. The relative contribution of extracellular NMN to intracellular NAD+ pools remains an area of active investigation, and the roles of specific transporters and enzymes are not completely defined.
| Property | Value | Notes |
|---|---|---|
| Typical storage temperature | −20 °C or below | Desiccated; amber container |
| Water solubility | Soluble | Polar; solution stability varies |
| Appearance | White to off-white powder | May be hygroscopic |
| Common analytical method | LC-MS/MS | Isotope-labeled internal standard often used |
| Common synonyms | NMN; β-nicotinamide mononucleotide | β form is commonly studied |
Analytical identification of NMN commonly uses high-performance liquid chromatography with ultraviolet detection, liquid chromatography-mass spectrometry, and nuclear magnetic resonance spectroscopy; HPLC can estimate purity by peak area, while mass spectrometry confirms molecular mass and fragmentation. NMR provides structural confirmation. Because NMN is charged, ion-pairing reagents or hydrophilic interaction liquid chromatography columns can improve retention and peak shape. In biological samples, LC-MS/MS with stable isotope internal standards is often used to quantify NMN and related NAD+ metabolites. Method validation is important because matrix effects and rapid enzymatic interconversion can complicate measurements.
Quality control for NMN typically checks identity, assay purity, residual solvents, heavy metals, and microbial limits, depending on the intended use and market. A certificate of analysis may report appearance, solubility, water content, and storage recommendations. Independent verification can compare chromatographic retention time and mass spectrum against a certified reference standard. Regulatory expectations differ between research chemicals, dietary ingredients, and pharmaceutical products. Impurity profiles and stability data are often requested for product approval, and open questions remain about how best to standardize NMN measurements across laboratories.
NMN is a polar, water-soluble nucleotide. In solid form it is usually a white to off-white powder. The compound is sensitive to heat, light, moisture, and extremes of pH, and aqueous solutions tend to degrade faster than dry material. Recommended storage for research samples is typically -20 °C or below in a sealed, desiccated container protected from light. Repeated freeze-thaw cycles should be avoided, and these handling practices help maintain identity and purity during laboratory use.
Terminology around NMN can be confusing because several related compounds share the vitamin B3 family. Nicotinamide riboside is a nucleoside, whereas NMN is a nucleotide with a phosphate group, and NAD+ is a dinucleotide coenzyme rather than a simple precursor. Niacin and nicotinamide are also NAD+ precursors but follow different metabolic entry points. In commercial and scientific writing, NMN usually refers to beta-nicotinamide mononucleotide unless another form is specified. Consistent nomenclature helps distinguish chemical identity from proposed biological effects.
Nicotinamide mononucleotide, commonly abbreviated NMN, is a pyridine nucleotide that consists of a nicotinamide ring, a ribose sugar, and a phosphate group. It is an intermediate in the salvage pathway for nicotinamide adenine dinucleotide, or NAD+, synthesis. In mammalian cells, the enzyme nicotinamide phosphoribosyltransferase produces NMN from nicotinamide and phosphoribosyl pyrophosphate. Nicotinamide mononucleotide adenylyltransferases then convert NMN into NAD+. The core structure and enzymatic route are well established in biochemical literature.
The biologically relevant form of NMN is generally the beta anomer, which is recognized by NMN adenylyltransferases. NMN is polar and water soluble, and it does not readily diffuse across lipid membranes without assistance. Whether intact NMN enters cells through a specific transporter remains an open question; some studies propose solute carrier family members, while other work favors extracellular dephosphorylation to nicotinamide riboside followed by uptake. This transport and compartmentalization debate affects how researchers interpret oral administration studies. The distinction between intracellular synthesis and extracellular delivery is central to current discussion.
Analytical laboratories identify and quantify NMN using several complementary techniques. High-performance liquid chromatography with ultraviolet detection is widely used for purity and assay work. Liquid chromatography coupled to mass spectrometry provides greater sensitivity and is common for biological matrices. Nuclear magnetic resonance spectroscopy supports structural confirmation and can distinguish related nucleotides. Accurate measurement depends on reference standards, validated methods, and careful sample preparation, especially because NMN can convert to related compounds under some conditions.
Regulatory treatment of NMN varies by jurisdiction and has changed over time. Some countries allow it in dietary supplements, while others treat it as a novel food ingredient requiring safety review. In the United States, the Food and Drug Administration has questioned whether NMN can be lawfully marketed as a dietary supplement because of drug preclusion provisions. Sports organizations have separate rules, and NMN is not currently on the World Anti-Doping Agency prohibited list. These differences create uncertainty for manufacturers, retailers, and researchers seeking consistent legal pathways.
=== Historical taxonomy === The taxonomy of Parmotrema perlatum has a rich history marked by periods of confusion and clarification that typify the dynamic nature of botanical classification. It was originally described as Lichen perlatus by William Hudson in his 1762 work Flora Anglica. Hudson described it as a foliaceous (leafy) lichen with creeping, lobed, and smooth characteristics, having a pearly edge, a farinaceous (pruinose) texture, and a black underside, adorned with slightly scalloped, brown, stalked fruiting bodies. The taxon was later transferred to the genus Parmelia by Erik Acharius in 1803, becoming Parmelia perlata. The name was well-established in scientific literature, being cited extensively in works like Alexander Zahlbruckner's popular 1929 catalogue. In 1952, Maurice Choisy reclassified it under the current name, Parmotrema perlatum. The nomenclature of Parmotrema perlatum was revisited in the late 20th century, amid a broader effort to clarify the typification and application of early lichen names. Mason Hale, in 1961, undertook a detailed restudy of the species, selecting a lectotype from the Dillenian collections—the herbarium and associated works of Johann Jacob Dillenius housed at the University of Oxford. This solidified the application of Hudson's name and was part of a larger trend in lichenology to fix historical names to specific herbarium specimens to stabilise nomenclature. The name Parmelia perlata was widely accepted until Hale and Ahti (1986) encountered the designation Lichen chinensis, introduced by Pehr Osbeck in 1757.
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
=== September === 6 September – The Minister for Agriculture, Charlie McConalogue, farming groups, and the Irish Creamery Milk Suppliers Association (ICMSA) reacted to the European Commission decision to cut Ireland's nitrates derogation limits from 250 kg of organic nitrogen per hectare to 220 kg per hectare. The ICMSA president, Pat McCormack, said that the "Government has put a nail in the coffin of many family dairy farms that have been worked for generations". 7 September – During an appearance on RTÉ News at One, Taoiseach Leo Varadkar said he believes Ireland is "on the path to unification" and that there will be a United Ireland in his lifetime. 26 September – Officials recovered 2,253 kg of cocaine after boarding MV Matthew, a Panamanian-registered ship, off the coast of Ireland. The operation was described by Gardaí as the largest drugs seizure in Ireland's history. 27 September – Using Dáil privilege, Mary Lou McDonald revealed details of a letter confirming a meeting between clinicians and a representative from Children's Health Ireland, concerning experimental spinal surgeries on children at Temple Street Hospital. Nineteen children had poor surgical outcomes following surgery at Temple Street, and one of children later died. Whether parental consent had been obtained is in dispute.
Sources: en.wikipedia.org
Systemic lupus erythematosus (SLE) Systemic sclerosis Polymyositis Dermatomyositis Rheumatoid arthritis (RA) Sjögren's syndrome Eosinophilic granulomatosis with polyangiitis (EGPA) Autoimmune thyroiditis Antiphospholipid antibody syndrome The treatment of overlapping connective tissue disorders is mainly based on the use of corticosteroids and immunosuppressants. Biologic drugs, i.e. anti-TNFα or anti-CD20 monoclonal antibodies, have been recently introduced as alternative treatments in refractory cases. There are some concerns with the use of anti-TNF agents in patients with systemic autoimmune diseases due to the risk of triggering disease exacerbations. The term polyangiitis overlap syndrome refers to a systemic vasculitis that shares features with two or more distinct vasculitis syndromes. The most common type of polyangiitis overlap syndrome is microscopic polyangiitis (MPA), which shares features with EGPA, granulomatosis with polyangiitis and panarteritis nodosa. Sometimes polyangiitis overlap syndrome is used as a synonym for MPA.
=== Acoustic droplet ejection === Acoustic droplet ejection (ADE) uses a pulse of ultrasound to move low volumes of fluids (typically nanoliters or picoliters) without any physical contact. This technology focuses acoustic energy into a fluid sample to eject droplets as small as a millionth of a millionth of a litre (picoliter = 10−12 litre). ADE technology is a very gentle process, and it can be used to transfer proteins, high molecular weight DNA and live cells without damage or loss of viability. This feature makes the technology suitable for a wide variety of applications including proteomics and cell-based assays.
In 2013, Xi announced the Belt and Road Initiative (BRI), a global infrastructure and economic development project. Encompassing much of Africa and Eurasia, the BRI became central to Chinese foreign policy and is the largest infrastructure investment by a great power since the Marshall Plan. In 2015, Xi announced the founding of the Asia Infrastructure Investment Bank, seen as a competitor to other multilateral banks such as the World Bank and the Asia Development Bank. Xi has unveiled the Global Development Initiative (GDI), the Global Security Initiative (GSI), the Global Civilisation Initiative (GCI), and the Global Governance Initiative (GGI) in 2021, 2022, 2023 and 2025 respectively, aiming to increase China's influence in the international order. Under Xi, China has, along with Russia, also focused on increasing relations with the Global South in order to blunt the effect of international sanctions.
== Market overview == The global market for laboratory-developed testing (LDT) is experiencing significant growth, with a projected value of US$ 4582.6 million by 2030 from US$ 3518.7 million in 2023 (CAGR of 3.8%). This growth is driven by advancements in genetic testing, the increasing demand for personalized medicine, and the ongoing expansion of the healthcare and diagnostics sectors.
Sources: en.wikipedia.org
Curing is any of various food preservation and flavoring processes of foods such as meat, fish and vegetables, by the addition of salt, with the aim of drawing moisture out of the food by the process of osmosis. Because curing increases the solute concentration in the food and hence decreases its water potential, the food becomes inhospitable for the microbial growth that causes food spoilage. Smoking and salting techniques improve on the drying process and add antimicrobial agents that aid in preservation. Smoke deposits a number of pyrolysis products onto the food, including the phenols syringol, guaiacol and catechol. Salt accelerates the drying process using osmosis and also inhibits the growth of several common strains of bacteria. More recently nitrites have been used to cure meat, contributing a characteristic pink colour. In 2015, the International Agency for Research on Cancer of the World Health Organization classified processed meat—i.e., meat that has undergone salting, curing, and smoking—as "carcinogenic to humans".
Public health care services are available for transgender individuals in Spain, although there has been debate over whether certain procedures should be covered under the public system. The region of Andalusia was the first to approve sex reassignment procedures, including sex reassignment surgery and mastectomies, in 1999, and several other regions have followed their lead in the following years. Multiple interdisciplinary clinics exist in Spain to cater specifically to diagnosing and treating transgender patients, including the Andalusian Gender Team. As of 2013, over 4000 transgender patients had been treated in Spain, including Spaniards and international patients. Beginning in 2007, Spain has begun allowing transgender individuals who are eighteen years or older to change their name and gender identity on public records and documents if they have been receiving hormone replacement therapy for at least two years.
=== Ears === Some people find whispering or breathing softly in the ear to be pleasurable and relaxing, as well as licking, biting, caressing and/or kissing it especially the area of and behind the earlobe.
=== Improvements in forensics === With the advent of and improvements to DNA testing/DNA profiling and other forensics technology, many cold cases are being re-opened and prosecuted. Police departments are opening cold case units whose job is to re-examine cold case files. DNA evidence helps in such cases but as in the case of fingerprints, it is of no value unless there is evidence on file to compare it to. However, to combat that issue, the FBI is switching from using the Integrated Automated Fingerprint Identification System (IAFIS) to using a newer technology called the Next Generation Identification (NGI). Other improvements in forensics lie in fields such as:
== Domestic commercialisation == Texturas is a range of products by Ferran Adrià, and his brother Albert Adrià. The products include the Sferificación, Gelificación, Emulsificación, Espesantes and Surprises lines. Texturas include products such as Xanthan and Algin which are packaged and labelled as Xantana Texturas and Algin Texturas respectively. Xanthan gum allows the user to use a very small amount to thicken soups, sauces and creams without changing the flavour. Algin is a key component of the "Spherification Kit" and is used for every spherical preparation: caviar, raviolis, balloons, gnocchi, pellets, and mini-spheres.
Sources: en.wikipedia.org
Liquid chromatography with tandem mass spectrometry is common because it can quantify low levels of NMN in complex samples. High-performance liquid chromatography with ultraviolet detection is used for simpler purity checks. Nuclear magnetic resonance can confirm identity and detect some impurities.
Solid NMN is typically kept desiccated at −20 °C or below and protected from light. Sealed containers reduce moisture exposure, which can promote degradation. Aqueous solutions are generally less stable and are often prepared fresh.
Important checks include identity confirmation, purity assay, moisture, heavy metals, residual solvents, and microbial contamination. A certificate of analysis should list the methods used and the specification limits. Independent testing can help verify supplier claims.
NMN is nicotinamide mononucleotide, a nucleotide intermediate in NAD+ biosynthesis. It occurs naturally in cells and is also produced commercially as a supplement ingredient.